Volume 13 , Issue 3 , September 2023
Aras Rafiq Mohammed 1 ; Dlnya Asad Mohamada 1 ; Mohammad Hamid 2
1 Molecular Biology, Department of Biology, College of Science, University of Sulaimani, Kurdistan Region, Iraq.
2 Department of Molecular Medicine, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran
Background
In recent years, additional sex comb-like 1 (ASXL1) gene mutations have recently been linked to several
myeloid cancers.
Objectives
To characterize ASXL1 mutation prevalence, determine if these abnormalities might constitute a significant
event in CML prognosis, and establish the correlations if these mutations are associated with CML
transformation and/or imatinib (IM) resistance, Here we designed a study to investigate ASXL1 gene that is
frequently mutated in myeloid malignancies and evaluated their occurrence in a well-defined group of CML
patients.
Patients and Methods
The study population consists of 80 patients diagnosed with CML under treatment with TKI (Imatinib
400,600,800 mg/day and Nilotinib). Ten healthy subjects were checked as controls. Depending on their
molecular and/or cytogenetic response, CML patients will either be classified into imatinib-resistant or
imatinib-good responders. Then the DNA was extracted depending on the Salting-Out protocol. Then genome
amplification was performed on exon 12 and in the HOT spot region for the detection of somatic mutations,
using conventional PCR.
Results
Nine out of 80 CML samples (11.25%) were determined to have mutations with the ASXL1 gene. We identified
a novel Mutation (c.1808_1820delCCTCCTGCCGGGG S603Ffs*96) in one of the patients that has not been
reported before. We also identified three other mutations (c.1933_1934del G p.G645Wfs*12, c.2047A>G
p.T683A, c.1900_1922 delAGAGAGGCGGCCACCACTGCCAT E635Rfs*15).
Conclusion
Our discovery of an ASXL1 mutation, a potential tumour suppressor gene, is a significant genetic aberration
in CML. Our findings suggest that ASXL1 mutations are common in patients with late stages of the disease
and imatinib therapy resistance.